Gpr135^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gpr135^em1(IMPC)J
• Name: G protein-coupled receptor 135; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5912036
• Gene: Gpr135 Location: Chr12:72114748-72117875 bp, - strand Genetic Position: Chr12, 30.2 cM
• Alliance: Gpr135^em1(IMPC)J page
• IMPC: Gpr135 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Gpr135-8910J-7449M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AACTGCATAATTCTGAAACC, CCGACTTCCATAACTGAGTC, CGGATGCGCGCTACCCTGCA and CTTGCAGGGTAGCGCGCATC, which resulted in a 1370 bp deletion beginning at Chromosome 12 negative strand position 72,071,005 bp and ending after 72,069,636 bp (GRCm38/mm10). This mutation creates an internal deletion of 1370 bp from ENSMUSE00000353393 (exon 1) including 14 bp of 5 UTR and 1356 bp of coding sequence, leaving 15 bp of coding sequence and a TAA stop. This deletion is predicted to result in a loss of almost all amino acid coding sequence for Grp135 and generate a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Gpr135 Mutation: 11 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)