About   Help   FAQ
Gpr135em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Gpr135em1(IMPC)J
Name: G protein-coupled receptor 135; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5912036
Gene: Gpr135  Location: Chr12:72114748-72117875 bp, - strand  Genetic Position: Chr12, 30.2 cM
Alliance: Gpr135em1(IMPC)J page
IMPC: Gpr135 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Gpr135-8910J-7449M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AACTGCATAATTCTGAAACC, CCGACTTCCATAACTGAGTC, CGGATGCGCGCTACCCTGCA and CTTGCAGGGTAGCGCGCATC, which resulted in a 1370 bp deletion beginning at Chromosome 12 negative strand position 72,071,005 bp and ending after 72,069,636 bp (GRCm38/mm10). This mutation creates an internal deletion of 1370 bp from ENSMUSE00000353393 (exon 1) including 14 bp of 5 UTR and 1356 bp of coding sequence, leaving 15 bp of coding sequence and a TAA stop. This deletion is predicted to result in a loss of almost all amino acid coding sequence for Grp135 and generate a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Gpr135 Mutation:  13 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory