About   Help   FAQ
Efcab7em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Efcab7em1(IMPC)J
Name: EF-hand calcium binding domain 7; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5912016
Gene: Efcab7  Location: Chr4:99717440-99769985 bp, + strand  Genetic Position: Chr4, 45.71 cM
Alliance: Efcab7em1(IMPC)J page
IMPC: Efcab7 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AACGTAGCCATCAATCAGTG, TCACTAGGTCACTTGGGGCT, TCTAGTAGATTTTTACTGCT and ATCTCAGGTTATCAACAATA, which resulted in a 500 bp deletion beginning at Chromosome 4 positive strand position 99,877,875 bp and ending after 99,878,374 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001051035, ENSMUSE00000631831 (exons 2,3) and 220 bp of flanking intronic sequence including the splice acceptors and donors. In addition there is 7 bp insertion at the deletion site (AAGGGGG) that will not alter the results of the exon deletions. This mutation is predicted to cause a change of amino acid sequence after residue 77 and early truncation 20 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Efcab7 Mutation:  43 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/30/2024
MGI 6.23
The Jackson Laboratory