Prim1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Prim1^em1(IMPC)J
• Name: DNA primase, p49 subunit; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5911622
• Gene: Prim1 Location: Chr10:127851084-127865899 bp, + strand Genetic Position: Chr10, 76.39 cM, cytoband D3
• Alliance: Prim1^em1(IMPC)J page
• IMPC: Prim1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TAACTAAAACCTTAACTAAT, GGTTACATTATGCCCTAAAC, ACATTACCTTCAAAACTTGG and TTCTTGCCCCCAAGTTTTGA, which resulted in a 278 bp deletion beginning at Chromosome 10 negative strand position 128,016,216 bp and ending after 128,016,216 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001205993 (exon 2) and 120 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 6 bp insertion (ATCTGA) at the deletion site and a 4 bp deletion (CTAA) 33 bp after the 278 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 34 and early truncation 21 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Prim1 Mutation: 29 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)