About   Help   FAQ
Ccdc191em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ccdc191em1(IMPC)J
Name: coiled-coil domain containing 191; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5911509
Gene: Ccdc191  Location: Chr16:43710172-43784677 bp, + strand  Genetic Position: Chr16, 28.44 cM, cytoband B4
Alliance: Ccdc191em1(IMPC)J page
IMPC: Ccdc191 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCCCAGTTGTACATTCCGAT, GAGAGTGGTCAGAGCTGTGA, GGTTTAATGCTGAGAAACGA and GCACTCGGAATGTGTTTGCA, which resulted in a 982 bp deletion beginning at Chromosome 16 positive strand position 43,943,264 bp and ending after 43,944,245 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000713202 (exon 9) and 521 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence and early truncation after residue 443. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ccdc191 Mutation:  42 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/30/2024
MGI 6.23
The Jackson Laboratory