Lrrc55em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Lrrc55em1(IMPC)J |
Name: |
leucine rich repeat containing 55; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5910550 |
Gene: |
Lrrc55 Location: Chr2:85018411-85029110 bp, - strand Genetic Position: Chr2, 49.53 cM
|
Alliance: |
Lrrc55em1(IMPC)J page
|
IMPC: |
Lrrc55 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences CGGATACAGCGCTGTACAGC and GCTGGCAGCAGCAGTGCTGT, which resulted in a 702 bp deletion beginning at Chromosome 2 negative strand position 85,196,683 bp and ending after 85,195,982 bp (GRCm38/mm10). This mutation deletes 702 bp from ENSMUSE00000643986 (exon 1) including the ATG start site but retains the last 3 bp (CGG) in the exon and thus the splice donor. While a null is expected, an unidentified alternate start site could potentially permit translation of exon 2.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|