Lins1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Lins1em1(IMPC)J |
Name: |
lines homolog 1; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5910408 |
Gene: |
Lins1 Location: Chr7:66339637-66367004 bp, + strand Genetic Position: Chr7, 36.08 cM
|
Alliance: |
Lins1em1(IMPC)J page
|
IMPC: |
Lins1 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences GCAACACAGGATAGAAGTGA, ATACACCACACGCCACTCCA and CCTGAGGTGGTAATCCTTTG, which resulted in a disrupted deletion of 466 bp in total beginning at Chromosome 7 positive strand position 66,709,117 bp and deleting 197 bases then 3 endogenous bp (GGT) are retained, followed by an additional deletion of 269 bp ending at 66,709,585 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001273824 (exon 5) and 327 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 181 and early truncation 1 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
3 reference(s) |
|