Ubap2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ubap2^em1(IMPC)J
• Name: ubiquitin-associated protein 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5910359
• Gene: Ubap2 Location: Chr4:41194313-41275144 bp, - strand Genetic Position: Chr4, 21.13 cM
• Alliance: Ubap2^em1(IMPC)J page
• IMPC: Ubap2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GAACGACCTGCAGCTCAGGT, TCTATAGCATGAATATCTGT, GTAGAGTCTATACCACTAAG and CTTGGCATACTAACTGCAGT, which resulted in a 437 bp deletion beginning at Chromosome 4 negative strand position 41,229,880 bp, and ending after 41,229,444 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001205355 (exon 5) and 283 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 96 and early truncation 221 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ubap2 Mutation: 108 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)