Dhtkd1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Dhtkd1em1(IMPC)J |
Name: |
dehydrogenase E1 and transketolase domain containing 1; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5910309 |
Gene: |
Dhtkd1 Location: Chr2:5901030-5947648 bp, - strand Genetic Position: Chr2, 3.62 cM
|
Alliance: |
Dhtkd1em1(IMPC)J page
|
IMPC: |
Dhtkd1 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences TAGTGGCGAGCGATCTTTGC, GTTTGTAATGGAGCTCACGG and CCGCCCAGAAGGGAAGTCGA, which resulted in a 597 bp deletion beginning at Chromosome 2 negative strand position 5,931,083 bp ACGGTGGAAGCAGCAGAGGC, and ending after TTCCTGCAAAGATCGCTCGC at 5,930,487 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000605446 (exon 3) and 385 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 105 and early truncation 1 amino acid later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|