About   Help   FAQ
Tm2d3em1(IMPC)J
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Tm2d3em1(IMPC)J
Name: TM2 domain containing 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5907977
Gene: Tm2d3  Location: Chr7:65343128-65351661 bp, + strand  Genetic Position: Chr7, 35.26 cM, cytoband C
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGGCTCGTATGTAGCATCGA, TAGGGCCTAGCAGTTCATAT, GATGGCCCTGGACCCACCTG and CGCAGGTCTACAAGACAAGG, which resulted in a 516 bp deletion beginning at Chromosome 7 positive strand position 65,697,589 bp, CTATATGAACTGCTAGGCCC, and ending after CAGACTAGCTTCCAGCGACA at 65,698,104 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000200011 (exon 3) and 341 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 2 bp intronic insertion TT 20 bp before the deletion and a 22 bp intronic deletion (CACCTGGGGCATCGCTTGCTTT) that is replaced with a 23 bp insertion (ATCGCTGGAAGCTAGTCTGAGAA 7:65,698,083-65,698,102) that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 92 and early truncation 59 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structures
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tm2d3 Mutation:  15 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
05/10/2022
MGI 6.19
The Jackson Laboratory