About   Help   FAQ
Tm2d3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tm2d3em1(IMPC)J
Name: TM2 domain containing 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5907977
Gene: Tm2d3  Location: Chr7:65343204-65351650 bp, + strand  Genetic Position: Chr7, 35.26 cM, cytoband C
Alliance: Tm2d3em1(IMPC)J page
IMPC: Tm2d3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGGCTCGTATGTAGCATCGA, TAGGGCCTAGCAGTTCATAT, GATGGCCCTGGACCCACCTG and CGCAGGTCTACAAGACAAGG, which resulted in a 516 bp deletion beginning at Chromosome 7 positive strand position 65,697,589 bp, CTATATGAACTGCTAGGCCC, and ending after CAGACTAGCTTCCAGCGACA at 65,698,104 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000200011 (exon 3) and 341 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 2 bp intronic insertion TT 20 bp before the deletion and a 22 bp intronic deletion (CACCTGGGGCATCGCTTGCTTT) that is replaced with a 23 bp insertion (ATCGCTGGAAGCTAGTCTGAGAA 7:65,698,083-65,698,102) that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 92 and early truncation 59 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tm2d3 Mutation:  18 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/30/2024
MGI 6.23
The Jackson Laboratory