About   Help   FAQ
Zfp385bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfp385bem1(IMPC)J
Name: zinc finger protein 385B; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5907974
Gene: Zfp385b  Location: Chr2:77240966-77648050 bp, - strand  Genetic Position: Chr2, 45.94 cM
Alliance: Zfp385bem1(IMPC)J page
IMPC: Zfp385b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATATGATATGTTTCCCTCAC, AACACATATTGCTTCCTGTG, CACCTCGTAGATAAATGCTG, and AGGAAGGTGAGACCAGTCAA, which resulted in a 447 bp deletion beginning at Chromosome 2 negative strand position 77,450,461 bp, ACCTCGTAGATAAATGCTGG, and ending after ATATGATATGTTTCCCTCAC at 77,450,015 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000326653 (exon 4) and 284 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is an 8 bp intronic deletion (GTTGACTG) 108 bp before the 447 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 67 and early truncation 5 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zfp385b Mutation:  23 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory