About   Help   FAQ
Rgsl1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rgsl1em1(IMPC)J
Name: regulator of G-protein signaling like 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5907831
Gene: Rgsl1  Location: Chr1:153655127-153719888 bp, - strand  Genetic Position: Chr1, 65.43 cM
Alliance: Rgsl1em1(IMPC)J page
IMPC: Rgsl1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGCTCTAGCAGTACACTATG, TGGGAGATCTTTGCTTAATG, CATTTCTGTCCATAGTTTGG and CAAGCTTTCATCTTTGAAAT, which resulted in a 321 bp deletion spanning ENSMUSE00001254521 (exon 12) beginning at Chromosome 1 negative strand position 153,804,855 bp, CTCATGAAACCACCAAACTA, and ending after AAGCCACATTAAGCAAAGAT at 153,804,535 bp (GRCm38/mm10). This mutation deletes exon 12 and 203 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 707 and early truncation 43 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Rgsl1 Mutation:  63 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory