About   Help   FAQ
Zfp940em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfp940em1(IMPC)J
Name: zinc finger protein 940; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5905739
Gene: Zfp940  Location: Chr7:29533943-29553101 bp, - strand  Genetic Position: Chr7, 17.26 cM
Alliance: Zfp940em1(IMPC)J page
IMPC: Zfp940 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Zfp940-8675J-5908M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTATTCTCTCTCATAACCG, TGCTGCTGCACGAACATTCA, AGGATACACCAAAATATCGG and AGAGCTGGTAGTCTGGAGTA, which resulted in a 478 bp deletion beginning at Chromosome 7 negative strand position 29,847,106 bp, TCCATGTCGCTTCCTGCCCT, and ending after CTCTCATAACCGAGGAACCA at 29,846,629 bp (GRCm38/mm10). This mutation deletes exon 3 and 351 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 3 and early truncation 40 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zfp940 Mutation:  27 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory