Zfp940em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Zfp940em1(IMPC)J |
Name: |
zinc finger protein 940; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5905739 |
Gene: |
Zfp940 Location: Chr7:29533943-29553101 bp, - strand Genetic Position: Chr7, 17.26 cM
|
Alliance: |
Zfp940em1(IMPC)J page
|
IMPC: |
Zfp940 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Zfp940-8675J-5908M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTATTCTCTCTCATAACCG, TGCTGCTGCACGAACATTCA, AGGATACACCAAAATATCGG and AGAGCTGGTAGTCTGGAGTA, which resulted in a 478 bp deletion beginning at Chromosome 7 negative strand position 29,847,106 bp, TCCATGTCGCTTCCTGCCCT, and ending after CTCTCATAACCGAGGAACCA at 29,846,629 bp (GRCm38/mm10). This mutation deletes exon 3 and 351 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 3 and early truncation 40 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|