Styxl1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Styxl1em1(IMPC)J |
Name: |
serine/threonine/tyrosine interacting-like 1; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5905733 |
Gene: |
Styxl1 Location: Chr5:135776074-135807239 bp, - strand Genetic Position: Chr5, 75.38 cM
|
Alliance: |
Styxl1em1(IMPC)J page
|
IMPC: |
Styxl1 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Styxl1-8615J-6464M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACAGGGAGTAAGTATCCACC, CGCAGAGAGCAGATGCACGG, ACTCAGAACTGGACACGTGA and ACATGAGAACACTGGTGGGC, which resulted in a 333 bp deletion beginning at Chromosome 5 negative strand position 135,768,952 bp, CGTGTCCAGTTCTGAGTTCA, and ending after AAGGTCCATACAGCCCCCG at 135,768,620 bp (GRCm38/mm10). This mutation deletes exon 3 and 271 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 34 and early truncation 55 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|