Rab8aem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Rab8aem1(IMPC)J |
Name: |
RAB8A, member RAS oncogene family; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5905648 |
Gene: |
Rab8a Location: Chr8:72915044-72935210 bp, + strand Genetic Position: Chr8, 34.84 cM
|
Alliance: |
Rab8aem1(IMPC)J page
|
IMPC: |
Rab8a gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Rab8a-8582J-1846M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGGCGACAACAGTAGCTGAA, CTAAAGCCTTCTACAGGCTG, CCAGTGTAGAGTCCAGCGAA and CACGATTCAGGGCCCAAACA, which resulted in a 233 bp deletion beginning at Chromosome 8 positive strand position 72,168,281 bp, CTTCAGCTACTGTTGTCGCC, and ending after GCTAGTGCCTTGTTTGGGCC at 72,168,513 bp (GRCm38/mm10). This mutation deletes exon 2 and 172 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp insertion (G) 18 bp after the exon deletion, that will not affect the results of the exon deletion. This allele is predicted to cause a change of amino acid sequence after residue 42 and early truncation 54 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|