About   Help   FAQ
Tmem171em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tmem171em1(IMPC)J
Name: transmembrane protein 171; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5904780
Gene: Tmem171  Location: Chr13:98822743-98831342 bp, - strand  Genetic Position: Chr13, 52.13 cM
Alliance: Tmem171em1(IMPC)J page
IMPC: Tmem171 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Tmem171-8631J-5335M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CATCAAAGCTCACAGAGCAG, GCTGAGTGTGAGCAGCGAGG, GAAACACCCTTGAGTGCGCG and ACTTGACATGGAACTGTCGC, which resulted in a 359 bp deletion beginning at Chromosome 13 negative strand position 98,688,580 bp, ACTCAAGGGTGTTTCGGCCT, and ending after TGTTTGAGATCCCGCCTCGC at 98,688,222 bp (GRCm38/mm10). This mutation deletes exon 3 and 223 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 6 bp (CTGTCG) intronic deletion 25 bp before the 359 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 213 and early truncation 86 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tmem171 Mutation:  22 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory