Syt14^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Syt14^em1(IMPC)J
• Name: synaptotagmin XIV; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5904336
• Gene: Syt14 Location: Chr1:192573541-192718083 bp, - strand Genetic Position: Chr1, 97.55 cM
• Alliance: Syt14^em1(IMPC)J page
• IMPC: Syt14 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Syt14-8616J-6466M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTCTCCTTGGCAACCACGG, TAAGGTACGAGAAGCTACAA, CTTATTGGATGAGAGGAGAG and TTATGAATTCTACACAGCAT, which resulted in a 544 bp deletion beginning at Chromosome 1 negative strand position 192,933,556 bp, GAGAGTGGAAAGCTAAGGAA, and ending after CAGTGTCTCATCCCTTGTAG at 192,933,013 bp (GRCm38/mm10). This mutation deletes exon 5 and 272 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 148 and early truncation 11 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Syt14 Mutation: 49 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)