About   Help   FAQ
Dusp22em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Dusp22em1(IMPC)J
Name: dual specificity phosphatase 22; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5903750
Gene: Dusp22  Location: Chr13:30844042-30895215 bp, + strand  Genetic Position: Chr13, 13.26 cM
Alliance: Dusp22em1(IMPC)J page
IMPC: Dusp22 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Intragenic deletion, Inversion
 
Mutation detailsThis allele from project Dusp22-8513J-1842M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATCCTGCTCCTAAGTGCAGG, CATGTTTGCCAAGGCCGTGA, CACTCAAACCCCAAGTCACA and CCCTGGCAATACCTTTTTGA, which resulted in a 490 bp deletion beginning at Chromosome 13 positive strand position 30,668,607 bp, GCAGGGGGTTGAAAGATTAC, and ending after TACCCTGGCAATACCTTTTT at 30,669,096 bp (GRCm38/mm10). This mutation deletes exon 2 and 456 bp of flanking intronic sequence including the splice acceptor and donor. In addition 71 bp upstream of the 490 bp deletion there is a deletion of 78 bp (Chr:13 30,668,458 bp - 30,668,535 bp) of intronic sequence that was replaced with 73 bp, the majority of which derived from the opposite strand of the excised sequence that reinserted in reverse orientation and should not alter the effect of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 7 and early truncation 7 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Dusp22 Mutation:  11 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory