About   Help   FAQ
Spata31d1dem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Spata31d1dem1(IMPC)J
Name: spermatogenesis associated 31 subfamily D, member 1D; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5903219
Gene: Spata31d1d  Location: Chr13:59873739-59879566 bp, - strand  Genetic Position: Chr13, 31.87 cM
Alliance: Spata31d1dem1(IMPC)J page
IMPC: Spata31d1d gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Spata31d1d-8598J-8838F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGAATAAGTGTATAAACTGG, GCATAGCCTACTCTTGTCAT, TGGACGTTTTGGGGATCCTA and TTCATCTGCAAGTTTCAGGC, which resulted in a 824 bp deletion beginning at Chromosome 13 negative strand position 59,730,873 bp, ATCCTAGGGAAAACATCAGG, and ending after TAGCCTACTCTTGTCATGGG at 59,730,050 bp (GRCm38/mm10). This mutation deletes exons 2-3 and 720 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is an additional 14 bp deletion 27 bp after the 824 bp deletion that will not alter the results of the exon deletions. This mutation is predicted to cause a change of amino acid sequence after residue 66 and early truncation 21 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Spata31d1d Mutation:  26 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory