Asmtem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Asmtem1(IMPC)J |
Name: |
acetylserotonin O-methyltransferase; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5903080 |
Gene: |
Asmt Location: ChrX:169106379-169111787 bp, + strand Genetic Position: ChrXY, Syntenic
|
Alliance: |
Asmtem1(IMPC)J page
|
IMPC: |
Asmt gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Asmt-8570J-1754F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTGGCCCCGCCCCATCCCCA, GGAGTGACGTCATCGGGGGC, GTGAAGCCCCGCCCACGGCG and CGTGACCTTTGACCTTCAGT, which resulted in a 405 bp deletion beginning at Chromosome X positive strand position 170,674,525 bp, GCCCCCGATGACGTCACTCC, and ending after GTGTTAGCGGGGTGGGCGGG at 170,674,929 bp (GRCm38/mm10). This mutation deletes exon 3 and 272 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp insertion (T) and a 4 bp deletion (CTGG) 165 bp before the 405 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 87 and early truncation 199 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|