About   Help   FAQ
Alpk2em1(IMPC)J
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Alpk2em1(IMPC)J
Name: alpha-kinase 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5901883
Gene: Alpk2  Location: Chr18:65265529-65393888 bp, - strand  Genetic Position: Chr18, 38.41 cM
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Alpk2-8569J-1734M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGGCAAACATGAGCACACCA, AGGTAATCCATTCATACAGA, GGTCAGTTGAAGTTATAAAT and ATCCCATTGTGCTCATCAAT, which resulted in a 493 bp deletion beginning at Chromosome 18 negative strand position 65,372,964 bp, TCAATAGGCCTTCTTATTAA, and ending after CTCCCTAGACAGTATAGCAC at 65,372,472 bp (GRCm38/mm10). In addition there is a 28 bp insertion, ATTGTAAAAGGGTCAGTTGAAGTTATTA, apparently from nearby Chr:18 65,372,889-65,372,916, into the deletion site that is not predicted to alter the results of the exon deletion. This mutation deletes exon 3 and 375 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 36 and early truncation 19 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structures
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Alpk2 Mutation:  57 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
12/03/2019
MGI 6.14
The Jackson Laboratory