About   Help   FAQ
Elmod3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Elmod3em1(IMPC)J
Name: ELMO/CED-12 domain containing 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5901857
Gene: Elmod3  Location: Chr6:72542905-72575396 bp, - strand  Genetic Position: Chr6, 32.27 cM
Alliance: Elmod3em1(IMPC)J page
IMPC: Elmod3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Elmod3-8514J-1055M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATAACCTAGCTCCTAACCCA, ACAGCAAGTGGACTTCTTGG, GCTGGAAGACTCTATTCTGA and CGCAGCTCTTCCCACCCACT, which resulted in a 351 bp deletion beginning at Chromosome 6 negative strand position 72,586,628 bp, TCCATCAGAATAGAGTCTTC, and ending after AACCCTGGGTTAGGAGCTAG at 72,586,278 bp (GRCm38/mm10). This mutation deletes exon 5 and 281 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 43 and early truncation 1 amino acid later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Elmod3 Mutation:  21 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory