Nt5dc3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nt5dc3^em1(IMPC)J
• Name: 5'-nucleotidase domain containing 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5901849
• Gene: Nt5dc3 Location: Chr10:86614869-86674253 bp, + strand Genetic Position: Chr10, 43.11 cM
• Alliance: Nt5dc3^em1(IMPC)J page
• IMPC: Nt5dc3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Nt5dc3-8542J-8383M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTGGGTGGCTTCTAAACAGA, TGTCATCTCCTGGGATAGAT, GGTCTGGGCATGAATGCGCA and TCTACTCTTCAGACACCAAA, which resulted in a 343 bp deletion beginning at Chromosome 10 positive strand position 86,804,714 bp, CTCTGTTTAGAAGCCACCCA, and ending after ATTCATGCCCAGACCCTGCC at 86,805,056 bp (GRCm38/mm10). This mutation deletes exon 2 and 158 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 67 and early truncation 8 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Nt5dc3 Mutation: 22 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)