About   Help   FAQ
Endonuclease-mediated Allele Detail
Symbol: Phkbem1(IMPC)J
Name: phosphorylase kinase beta; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5901846
Gene: Phkb  Location: Chr8:86567588-86788005 bp, + strand  Genetic Position: Chr8, 41.61 cM
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
Mutation detailsThis allele from project Phkb-8543J-8397M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTAATGCTCTAAGTAGTTGG, TGTGCAGTATGGATTTGCAG, GTTCTCCTGCTAACTCCACG and CTCGTCCACGTGGAGTTAGC, which resulted in a 329 bp deletion beginning at Chromosome 8 positive strand position 85,877,961 bp, ATTTGCAGTGGGCTAGAGTT, and ending after TGCTAACTCCACGTGGACGA at 85,878,289 bp (GRCm38/mm10). This mutation deletes exon 4 and 190 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 47 and early truncation 17 amino acids later. (J:188991)
Inheritance:    Not Specified
View phenotypes and curated references for all genotypes (concatenated display).
In Structures Affected by this Mutation: 2 anatomical structures
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Phkb Mutation:  49 strains or lines available
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
MGI 6.17
The Jackson Laboratory