About   Help   FAQ
Endonuclease-mediated Allele Detail
Symbol: Ubiad1em1(IMPC)J
Name: UbiA prenyltransferase domain containing 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5896808
Gene: Ubiad1  Location: Chr4:148518952-148529217 bp, - strand  Genetic Position: Chr4, 78.76 cM, cytoband E1
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
Mutation detailsThis allele from project Ubiad1-8387J-M4740 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTTAGGGAGAAGTGCCATA, ACTGTTCCCAAATTCATCAC, AGAATACCATGTCTGAAGAG and TCCGGGTACACAGAGATGAG, which resulted in a 2599 bp deletion beginning at Chromosome 4 negative strand position 148,436,873 bp, TCTCTGTGTACCCGGAGCTC, and ending after AGGACTTAGGGAGAAGTGCC at 148,434,275 bp (GRCm38/mm10). This mutation deletes exon 2 and 451 bp of flanking intronic sequence including the splice acceptor and is predicted to cause early truncation after amino acid residue 174. (J:188991)
Inheritance:    Not Specified
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ubiad1 Mutation:  22 strains or lines available
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
MGI 6.17
The Jackson Laboratory