About   Help   FAQ
B3galnt2em1(IMPC)J
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: B3galnt2em1(IMPC)J
Name: UDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5883341
Synonyms: B3galnt2em1J
Gene: B3galnt2  Location: Chr13:14129059-14173688 bp, + strand  Genetic Position: Chr13, 5.29 cM
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project B3galnt2-7842J-F8897 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCTGGCCTAACAAAAGGAGA, CTCAGTAGTTAGCAGCCCTT, TAAATTCGTTGTCAAGTAAA and CAGACTTATTAGACTTATTA, which resulted in a two-part deletion of 379 bp in total. This deletion begins at Chromosome 13 positive strand position 13,970,629 bp deletes 29 bp CCCTTGGGTTTCATGCCCTCTCCTTTTGT, then retains 3 endogenous bp (TAG) in the intron, then removes 350 bp and ends after TGACAGACTTATTAGACTTA at 13,971,010 bp (GRCm38/mm10). This mutation deletes exon 3 and 278 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 88 and early truncation 5 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structures
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any B3galnt2 Mutation:  59 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
05/10/2022
MGI 6.19
The Jackson Laboratory