B3galnt2em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
B3galnt2em1(IMPC)J |
Name: |
UDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 2; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5883341 |
Synonyms: |
B3galnt2em1J |
Gene: |
B3galnt2 Location: Chr13:14129059-14173688 bp, + strand Genetic Position: Chr13, 5.29 cM
|
Alliance: |
B3galnt2em1(IMPC)J page
|
IMPC: |
B3galnt2 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project B3galnt2-7842J-F8897 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCTGGCCTAACAAAAGGAGA, CTCAGTAGTTAGCAGCCCTT, TAAATTCGTTGTCAAGTAAA and CAGACTTATTAGACTTATTA, which resulted in a two-part deletion of 379 bp in total. This deletion begins at Chromosome 13 positive strand position 13,970,629 bp deletes 29 bp CCCTTGGGTTTCATGCCCTCTCCTTTTGT, then retains 3 endogenous bp (TAG) in the intron, then removes 350 bp and ends after TGACAGACTTATTAGACTTA at 13,971,010 bp (GRCm38/mm10). This mutation deletes exon 3 and 278 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 88 and early truncation 5 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|