About   Help   FAQ
Lpgat1em1(IMPC)J
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Lpgat1em1(IMPC)J
Name: lysophosphatidylglycerol acyltransferase 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5829401
Synonyms: Lpgat1em1J
Gene: Lpgat1  Location: Chr1:191449946-191516367 bp, + strand  Genetic Position: Chr1, 96.78 cM
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Lpgat1-8352J-F7972 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAACTTAGATGTTTACCAAC, ATTTTTCTAAGTTTGAAACT, CCTCGGGAGGATATCCTGCA and GTCTTAAAATTCCCTTCCTG, which resulted in a 585 bp deletion beginning at Chromosome 1 positive strand position 191,749,206 bp TGAATTCTTTCCCATGATAT, 15 bases later there is retention of 5 endogenous bp (TAAGT) in the intron, and ending after CAGGAAGGGAATTTTAAGAC at 191,749,795 bp (GRCm38/mm10). This mutation deletes exon 3 and 466 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 79 and early truncation 48 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Lpgat1 Mutation:  13 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
01/12/2022
MGI 6.17
The Jackson Laboratory