Rr40^tm1.1Ptsn
Targeted Allele Detail

Summary

• Symbol: Rr40^tm1.1Ptsn
• Name: regulatory region 40; targeted mutation 1.1, Part Peterson
• MGI ID: MGI:5829272
• Gene: Rr40 Location: Chr10:77882379-77882423 bp Genetic Position: Chr10, Syntenic
• Alliance: Rr40^tm1.1Ptsn page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:233730
• Parent Cell Line: W4 (ES Cell)
• Strain of Origin: 129S6/SvEvTac

Mutation description

• Allele Type: Targeted (Modified regulatory region, Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: The 45 bp (CTGTCACGGAAACCCCCACGTGTGATGGAAAGTCCAAAATTGTAC) Aire enhancer region within the conserved noncoding sequence 1 (CSN1) region, including two Nfkb1 binding sites, was replaced with a floxed neomycin resistance cassette. Cre-mediated recombination removed the selection cassette. (J:233730)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr40 Mutation: 0 strains or lines available

References

• Original: J:233730 Haljasorg U, et al., A highly conserved NF-kappaB-responsive enhancer is critical for thymic expression of Aire in mice. Eur J Immunol. 2015 Dec;45(12):3246-56
• All: 2 reference(s)