Gsto1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Gsto1em1(IMPC)J |
Name: |
glutathione S-transferase omega 1; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5827741 |
Synonyms: |
Gsto1em1J |
Gene: |
Gsto1 Location: Chr19:47843412-47853229 bp, + strand Genetic Position: Chr19, 40.41 cM
|
Alliance: |
Gsto1em1(IMPC)J page
|
IMPC: |
Gsto1 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Gsto1-8314J-F9698 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCAGGAGGGCATCTGACCCA, AATCGGGCCACACTAATTCA, ACTCAGCGCTGCCTTTGTGA and AGCAGGAACAGAGCGTGCCA, which resulted in a deletion of 443 bp in total. This deletion begins at Chromosome 19 positive strand position 47,857,710 bp deleting 21 bp, CCCAGGGTCTTAACCTTCGGG, then retains 4 endogenous bp (TGCA) in the intron, then removes 422 bp ending after ACTCAGCGCTGCCTTTGTGA at 47,858,156 bp (GRCm38/mm10). This mutation deletes exon 3 and 223 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 48 and early truncation 3 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|