Tcn2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tcn2^em1(IMPC)J
• Name: transcobalamin 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5827580
• Synonyms: Tcn2^em1J
• Gene: Tcn2 Location: Chr11:3867192-3882159 bp, - strand Genetic Position: Chr11, 2.76 cM
• Alliance: Tcn2^em1(IMPC)J page
• IMPC: Tcn2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Tcn2-8386J-M4720 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGATCCAAGTTATAAGAGAT, TATAACTTGGATCAAGTCAC, ATAGAGGGCATTTCTCCTGG and ATAGTTGCTTGCTAGTGGCA, which resulted in a 646 bp deletion beginning at Chromosome 11 negative strand position 3,927,730 bp GCATTTCTCCTGGCGGGCTG, and ending after CAGGCTGGATTCTAATTGGG at 3,927,085 bp (GRCm38/mm10). This mutation deletes exon 3 and 453 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 21 and early truncation 41 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tcn2 Mutation: 20 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)