Arl2bpem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Arl2bpem1(IMPC)J |
Name: |
ADP-ribosylation factor-like 2 binding protein; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5825297 |
Synonyms: |
Arl2bpem1J |
Gene: |
Arl2bp Location: Chr8:95393228-95401053 bp, + strand Genetic Position: Chr8, 46.65 cM, cytoband C5
|
Alliance: |
Arl2bpem1(IMPC)J page
|
IMPC: |
Arl2bp gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Arl2bp-8260J-M6258 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGATTGGTGAAACTGAGTGA, AAAACACTCGTGACGAAAAC, AATTGACCATAGGAACTAGA and TTACATATGTGATGGATCGT, which resulted in a 394 bp deletion beginning at Chromosome 8 positive strand position 94,667,392 bp, GTGAAACTGAGTGATGGGAG, and ending after TTTACATATGTGATGGATC at 94,667,785 bp (GRCm38/mm10). This mutation deletes exon 2 and 332 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 12 and early truncation 1 amino acid later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|