Kctd1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kctd1^em1(IMPC)J
• Name: potassium channel tetramerisation domain containing 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5825137
• Synonyms: Kctd1^em1J
• Gene: Kctd1 Location: Chr18:15101742-15284503 bp, - strand Genetic Position: Chr18, 8.28 cM
• Alliance: Kctd1^em1(IMPC)J page
• IMPC: Kctd1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Kctd1-8309J-F0739 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGACCTACAGAAGCTGCTCA, CTCCATGTCCCCGCTTGTGG, CACAGTATACAAATAACAAG and TTACTGCAATTGATCCCCAT, which resulted in a 571 bp deletion beginning at Chromosome 18 negative strand position 15,008,135 bp, TTGTTATTTGTATACTGTGA, and ending after GCCATGGATGCCTGGCCTCC at 15,007,565 bp (GRCm38/mm10). This mutation deletes exon 2 and 392 bp of flanking intronic sequence including the splice acceptor and donor. There is a small 6 bp insertion (CCTCCA) at the deletion site that will not alter the results of the mutation. This mutation is predicted to cause a change of amino acid sequence after residue 3 and early truncation 5 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

6 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Kctd1 Mutation: 39 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)