About   Help   FAQ
Efhd1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Efhd1em1(IMPC)J
Name: EF hand domain containing 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5825125
Synonyms: Efhd1em1J
Gene: Efhd1  Location: Chr1:87192085-87238561 bp, + strand  Genetic Position: Chr1, 44.15 cM
Alliance: Efhd1em1(IMPC)J page
IMPC: Efhd1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Efhd1-8204J-F5406 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCGGAGGCTTGCAAAGCAGG, GGAGGTGCCTTACTGTGAAG, AACCAGGGAGCATTCTCAAT and TGCCGATTGAGAATGCTCCC, which resulted in a 540 bp deletion beginning at Chromosome 1 negative strand position 87,289,692 bp ATTCTCAATCGGCAGATCCA, and ending after GGACCCAACACCTCCAAATG at 87,289,147 bp (GRCm38/mm10). This mutation deletes exon 2 and 392 bp of flanking intronic sequence (retains 6 bp CTCCGC at 87289348-87289343) including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 102 and early truncation 58 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Efhd1 Mutation:  18 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory