Rr505em2Rlb
Endonuclease-mediated Allele Detail
|
Symbol: |
Rr505em2Rlb |
Name: |
regulatory region 505; endonuclease-mediated mutation 2, Robin Lovell-Badge |
MGI ID: |
MGI:5824891 |
Synonyms: |
Sox9em2Rlb, TESCO- |
Gene: |
Rr505 Location: Chr11:112660478-112661770 bp Genetic Position: Chr11, Syntenic
|
Alliance: |
Rr505em2Rlb page
|
|
|
Allele Type: |
|
Endonuclease-mediated (Modified regulatory region) |
Mutations: |
|
Insertion, Intergenic deletion
|
|
|
Mutation details: The core region (TESCO) of the TES regulatory region 10-13 kb upstream of the gene was targeted with a pair of single guide RNAs (sgRNAs) using the CRISPR/Cas9 system. The proximal sgRNA (equivalent to TCTGTTAACGTATGACACGA) was targeted to sequence 8 bp downstream of the 3'. The distal sgRNA (equivalent to GTTGGAGTTCCGATTTAGA) was targeted to sequence 41 bp downstream of the 5' end of the region (i.e. inside the region). Two stable lines were established that carried the exact 1260 bp deletion between the Cas9 cleavage sites. This 1260 bp deletion deletes 1252 of the 1293 bp TESCO sequence. This line also carried an 11 bp insertion of unrecognized sequence at the cleavage site. Only one of the lines was used for the experiments.
(J:238708)
|
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Rr505 Mutation: |
0 strains or lines available
|
|
Original: |
J:238708 Gonen N, et al., Normal Levels of Sox9 Expression in the Developing Mouse Testis Depend on the TES/TESCO Enhancer, but This Does Not Act Alone. PLoS Genet. 2017 Jan;13(1):e1006520 |
All: |
1 reference(s) |
|