Alg9^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Alg9^em1(IMPC)J
• Name: ALG9 alpha-1,2-mannosyltransferase; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5823410
• Synonyms: Alg9^em1J
• Gene: Alg9 Location: Chr9:50686570-50754939 bp, + strand Genetic Position: Chr9, 27.75 cM
• Alliance: Alg9^em1(IMPC)J page
• IMPC: Alg9 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Alg9-8257J-M6224 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTATCAGGAAGGTCCTGCTA, TTAGTGTGTACCTTAGAAGC, TCGCCTAAATTTGAGCTGCT and TTGATCTTGATTTGGTACTT, which resulted in a 484 bp deletion beginning at Chromosome 9 negative strand position 50,776,825 bp, GTACCAAATCAAGATCAAAG, and ending after CGTCCACTTCCTGCTTCTAA at 50,776,342 bp (GRCm38/mm10). This mutation deletes exon 2 and 348 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 46 and early truncation 51 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Alg9 Mutation: 36 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)