C7em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
C7em1(IMPC)J |
Name: |
complement component 7; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5823284 |
Synonyms: |
C7em1J |
Gene: |
C7 Location: Chr15:5018244-5093222 bp, - strand Genetic Position: Chr15, 1.98 cM
|
Alliance: |
C7em1(IMPC)J page
|
IMPC: |
C7 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project C7-8272J-M2250 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AAACCAGAACAAAAACCGTG, TCTGAAAACACGGAAAGATA, GCACTTAAGTGTGGATTTGT and TAAATACTTGCACTTAAGTG, which resulted in a 247 bp deletion beginning at Chromosome 15 negative strand position 5,059,535 bp, AATCCACACTTAAGTGCAAG, and ending after TTAGATGTTTATGCACCTTAT at 5,059,289 bp (GRCm38/mm10). This mutation deletes exon 2 and 191 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 2 and early truncation 42 amino acids later. In addition there is a single bp deletion (G) in the intron 91 bases after the deletion that will not alter the results of the deletion.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
5 reference(s) |
|