About   Help   FAQ
Fdx2em2Murr
Endonuclease-mediated Allele Detail
Summary
Symbol: Fdx2em2Murr
Name: ferredoxin 2; endonuclease-mediated mutation 2, Stephen Murray
MGI ID: MGI:5819264
Gene: Fdx2  Location: Chr9:20978808-20984827 bp, - strand  Genetic Position: Chr9, 7.7 cM, cytoband A3
Alliance: Fdx2em2Murr page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Single point mutation
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and single guide sequence TCCGGTCACGTGGCCTATCA, which resulted in a G>T Knock-in at Chromosome 9 negative strand position 21073504 (GRCm38/mm10). This mutation changes the G nucleotide to a T at this position and is predicted to cause a change of amino acid sequence at residue 1, mimicking the human p.M1T mutation. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Fdx2 Mutation:  13 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory