Fdx2^em2Murr
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fdx2^em2Murr
• Name: ferredoxin 2; endonuclease-mediated mutation 2, Stephen Murray
• MGI ID: MGI:5819264
• Gene: Fdx2 Location: Chr9:20978808-20984827 bp, - strand Genetic Position: Chr9, 7.7 cM, cytoband A3
• Alliance: Fdx2^em2Murr page

Mutation origin

• Strain of Origin: C57BL/6NJ

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Single point mutation
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and single guide sequence TCCGGTCACGTGGCCTATCA, which resulted in a G>T Knock-in at Chromosome 9 negative strand position 21073504 (GRCm38/mm10). This mutation changes the G nucleotide to a T at this position and is predicted to cause a change of amino acid sequence at residue 1, mimicking the human p.M1T mutation. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Fdx2 Mutation: 13 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)