Rad54l^em2Murr
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rad54l^em2Murr
• Name: RAD54 like (S. cerevisiae); endonuclease-mediated mutation 2, Stephen Murray
• MGI ID: MGI:5819223
• Gene: Rad54l Location: Chr4:115951458-115980875 bp, - strand Genetic Position: Chr4, 53.1 cM
• Alliance: Rad54l^em2Murr page

Mutation origin

• Strain of Origin: C57BL/6NJ

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Single point mutation
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and single guide sequence TTGGTGCACTTTGTAAATTC, which resulted in a G>T Knockin at Chromosome 4 negative strand position 116,105,767 bp (GRCm38/mm10). This mutation changes the G nucleotide at c.1033G to a T at this position and is predicted to cause a change of amino acid sequence at residue p.G345C, mimicking the human p.G345C mutation. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rad54l Mutation: 48 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)