Osbpl5^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Osbpl5^em1(IMPC)J
• Name: oxysterol binding protein-like 5; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5818708
• Synonyms: Osbpl5^em1J
• Gene: Osbpl5 Location: Chr7:143242499-143310722 bp, - strand Genetic Position: Chr7, 88.29 cM
• Alliance: Osbpl5^em1(IMPC)J page
• IMPC: Osbpl5 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Osbpl5-8180J-F0511 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCTCAAACTGCAGAGCCAGG, AGTGAGAGAGTCACACAAAT, GGTGGCCCCGAAGAGTGAGG and TCAGACCTCATCTAAGGCTA, which resulted in a 309 bp deletion beginning at Chromosome 7 negative strand position 143715937 bp, CTCACTCTTCGGGGCCACCT, and ending after GGATCTGGGGTCCTCCTGGC at 143,715,629 bp (GRCm38/mm10). This mutation deletes exon 2 and 152 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 17 and early truncation 75 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Osbpl5 Mutation: 50 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)