Gnb2em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Gnb2em1(IMPC)J |
Name: |
guanine nucleotide binding protein (G protein), beta 2; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5817218 |
Synonyms: |
Gnb2em1J |
Gene: |
Gnb2 Location: Chr5:137526389-137531772 bp, - strand Genetic Position: Chr5, 76.54 cM
|
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC |
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Gnb2-8128J-M9422 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCCCATTCTTCAGTGCCCCA, ATGGGCAGAATGATAGTACA, TCCCATTCTTCAGTGCCCCA and ATGATGGGCAGTGCAAGAGA, which resulted in a 359 bp deletion beginning at Chromosome 5 negative strand position 137,530,468 bp, TTTCCCTCTCTTGCACTGCC, and ending after ATGGGCAGAATGATAGTACA at 137,530,110 bp (GRCm38/mm10). This mutation deletes all of exons 3 and 4 and 106 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 2bp (AA) deletion 90 bp before the large deletion that will not effect the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 19 and early truncation 19 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
3 reference(s) |
|