C2cd2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: C2cd2^em1(IMPC)J
• Name: C2 calcium-dependent domain containing 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5817198
• Synonyms: C2cd2^em1J
• Gene: C2cd2 Location: Chr16:97656409-97727248 bp, - strand Genetic Position: Chr16, 57.7 cM, cytoband C4
• Alliance: C2cd2^em1(IMPC)J page
• IMPC: C2cd2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project C2cd2-8190J-M1399 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTTTCACTATATTTCTGCAG, CTAATGGGCTTGGGGTCCAA, AGGATGTGTGAGGTTGGCCA and ACAGAGTCATCACTATTTGC, which resulted in a 353 bp deletion beginning at Chromosome 16 negative strand position 97,883,448 bp CTGGCCAACCTCACACATCC, and ending after GGGCTTGGGGTCCAAAGGCC at 97,883,096 bp (GRCm38/mm10). This mutation deletes exon 6 and 229 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is an 11 bp deletion (ATTTGCAGGTT) 159 bp before the 353 bp deletion that will not effect the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 236 and early truncation 9 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any C2cd2 Mutation: 27 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)