Slmap^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slmap^em1(IMPC)J
• Name: sarcolemma associated protein; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5812880
• Synonyms: Slmap^em1J
• Gene: Slmap Location: Chr14:26134323-26256086 bp, - strand Genetic Position: Chr14, 16.09 cM, cytoband B
• Alliance: Slmap^em1(IMPC)J page
• IMPC: Slmap gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Slmap-8150J-M2409 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTTAAGATGAACTTACAGCG, CTATAGTGTCAGGAAGCGCT, TGAGTGGTTTCAGTTGATAG and CGTCTCAAAACTTTTAAAGA, which resulted in a 544 bp deletion beginning at Chromosome 14 negative strand position 26,483,082 bp, GTTTCAGTTGATAGGGGAAA, and ending after TAAGATGAACTTACAGCGTG at 26,482,539 bp (GRCm38/mm10). This mutation deletes exon 3 and 396 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 66 and early truncation 9 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Slmap Mutation: 68 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)