Arv1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Arv1^em1(IMPC)J
• Name: ARV1 homolog, fatty acid homeostasis modulator; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5810348
• Synonyms: Arv1^em1J
• Gene: Arv1 Location: Chr8:125448878-125460862 bp, + strand Genetic Position: Chr8, 72.81 cM
• Alliance: Arv1^em1(IMPC)J page
• IMPC: Arv1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Arv1-8104J-M9010 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGTAAAGAAGCCGTGAGCCG, GCTGCGGTAGGTATGCCTCT, TTAGTGGCTGAGCTGAGATA and GCATTACTAGTTGTCTCACC, which resulted in a 290 bp deletion beginning at Chromosome 8 positive strand position 124,728,265bp TCTTGGCATGCCCTCGGCTC and ending after AATCAAAGCTAAGACCTGGT at 124,728,554 bp (GRCm38/mm10). This mutation deletes exon 3 and 154 bp of flanking intronic sequence including the splice acceptor and donor, in addition there is a 2 bp deletion in intron 4 after the 290 bp deletion that will not alter the effect of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 93 and early truncation 18 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Arv1 Mutation: 15 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)