About   Help   FAQ
Tex15em1Jcs
Endonuclease-mediated Allele Detail
Summary
Symbol: Tex15em1Jcs
Name: testis expressed gene 15 meiosis and synapsis associated; endonuclease-mediated mutation 1, John C Schimenti
MGI ID: MGI:5804172
Synonyms: Tex15T2181I
Gene: Tex15  Location: Chr8:34006766-34075610 bp, + strand  Genetic Position: Chr8, 20.59 cM
Alliance: Tex15em1Jcs page
Mutation
origin
Strain of Origin:  FVB/NJ x B6(Cg)-Tyrc-2J/J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsUsing an sgRNA (targeting AGTTTCCACGTATATTGACT) and ssODN template (AACTTACAGGCGTTAAAAGGCTTCTGAATAACTCTAAGTATTCAGTTTCCATATATATTGACTTGGTGCCACATACTGCATCTGTAAATTTTGGAAACACTGTGGCAGAATTAGAACATAACTACA) with CRISPR/Cas9 technology, threonine codon 2188 (ACG) was changed to isoleucine (ATA) (c.6563_6564delCGinsTA, p.T2188I). This is the equivalent of the human p.T2181I mutation caused by SNP rs61735519. (J:226562)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Tex15 Mutation:  115 strains or lines available
References
Original:  J:226562 Singh P, et al., The genetics of human infertility by functional interrogation of SNPs in mice. Proc Natl Acad Sci U S A. 2015 Aug 18;112(33):10431-6
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory