Smc1b^em1Jcs
Endonuclease-mediated Allele Detail

Summary

• Symbol: Smc1b^em1Jcs
• Name: structural maintenance of chromosomes 1B; endonuclease-mediated mutation 1, John C Schimenti
• MGI ID: MGI:5804171
• Synonyms: Smc1b^F1055L
• Gene: Smc1b Location: Chr15:84948890-85016158 bp, - strand Genetic Position: Chr15, 40.25 cM, cytoband E3
• Alliance: Smc1b^em1Jcs page

Mutation origin

• Strain of Origin: FVB/NJ x B6(Cg)-Tyr^c-2J/J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Using an sgRNA (targeting GAATATGTAGGCAAGAGTTTGAAC) and ssODN template (TTCTTAGTTTTTGAGGCCAGCAGAAAGGAAGCCAGAATATGTAGGCAAGAGTTGGAACAGGTGAAAAGACGGAGGTACGATGCTTTCAGTCAATGTTTTGAACACATCTCAGTCTCAATTGATCAA) with CRISPR/Cas9 technology, phenylalanine codon 1054 (TTT) was changed to leucine (TTG) (c.3162T>G, p.F1054L). This is the equivalent of the human p.F1055L mutation caused by SNP rs61735519. (J:226562)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Smc1b Mutation: 68 strains or lines available

References

• Original: J:226562 Singh P, et al., The genetics of human infertility by functional interrogation of SNPs in mice. Proc Natl Acad Sci U S A. 2015 Aug 18;112(33):10431-6
• All: 1 reference(s)