Mlh1^em1Jcs
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mlh1^em1Jcs
• Name: mutL homolog 1; endonuclease-mediated mutation 1, John C Schimenti
• MGI ID: MGI:5804170
• Synonyms: Mlh1^V384D
• Gene: Mlh1 Location: Chr9:111057296-111100854 bp, - strand Genetic Position: Chr9, 60.92 cM
• Alliance: Mlh1^em1Jcs page

Mutation origin

• Strain of Origin: FVB/NJ x B6(Cg)-Tyr^c-2J/J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Using an sgRNA (targeting CGCTTACCAGATGGTCCGTA) and ssODN template (CACGACAGGGGTGGCTTCCTCATCCACTAGTGGAAGTGGCGACAAGGTCTACGCTTACCAGATGGATCGTACGGACTCCCGGGAGCAGAAGCTTGACGCCTTTCTGCAGCCTGTAAGCAGCCTTGGG) with CRISPR/Cas9 technology, valine codon 384 (GTC) was changed to aspartic acid (GAT) (c.1151_1152delTCinsAT, p.V384D). This mutation mimics human SNP rs63750447. (J:226562)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Mlh1 Mutation: 42 strains or lines available

References

• Original: J:226562 Singh P, et al., The genetics of human infertility by functional interrogation of SNPs in mice. Proc Natl Acad Sci U S A. 2015 Aug 18;112(33):10431-6
• All: 1 reference(s)