About   Help   FAQ
Abcd3em1(IMPC)J
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Abcd3em1(IMPC)J
Name: ATP-binding cassette, sub-family D (ALD), member 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5803796
Synonyms: Abcd3em1J
Gene: Abcd3  Location: Chr3:121758904-121815302 bp, - strand  Genetic Position: Chr3, 52.94 cM, cytoband G-H1
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Abcd3-7998J-F9901 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTTCATTCACTTTCTCTTGT, AACAACAATGCTTAACTACA, TTAACATTCTGCAATGCATT and CAGTAACTTGGTGAAGCTCT, which resulted in a 219 bp deletion beginning at Chromosome 3 negative strand position 121,791,897 bp, CAAGAGCTTCACCAAGTTAC, and ending after TAGTTTGCCTTGTAGTTAAG at 121,791,679 bp (GRCm38/mm10). This mutation deletes exon 4 and 130 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 82 and early truncation 27 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structures
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Abcd3 Mutation:  7 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/05/2019
MGI 6.14
The Jackson Laboratory