Gabarapl1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gabarapl1^em1(IMPC)J
• Name: GABA type A receptor associated protein like 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5796285
• Synonyms: Gabarapl1^em1J
• Gene: Gabarapl1 Location: Chr6:129510155-129519294 bp, + strand Genetic Position: Chr6, 63.39 cM
• Alliance: Gabarapl1^em1(IMPC)J page
• IMPC: Gabarapl1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Gabarapl1-7880J-F7865 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TATAAAAGTCATTCACCCTA, AACTACAAATTACCTATAAA, GGGTTGTCACTGCATGTAGG and GTGAGCTGGCCAGTACAGAT, which resulted in a 368 bp deletion beginning at Chromosome 6 positive strand position 129,537,347 bp, GTAATTTGTAGTTGTTTAAA, and ending after GAGCTGGCCAGTACAGATAG at 129,537,714 bp (GRCm38/mm10). This mutation deletes exon 2 and 79 bp of flanking intronic sequence including the splice acceptor and donor. There is a single bp insertion G at the deletion site that will not alter the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 30 and early truncation 6 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Gabarapl1 Mutation: 15 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)