About   Help   FAQ
Gabarapl1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Gabarapl1em1(IMPC)J
Name: GABA type A receptor associated protein like 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5796285
Synonyms: Gabarapl1em1J
Gene: Gabarapl1  Location: Chr6:129510155-129519294 bp, + strand  Genetic Position: Chr6, 63.39 cM
Alliance: Gabarapl1em1(IMPC)J page
IMPC: Gabarapl1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Gabarapl1-7880J-F7865 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TATAAAAGTCATTCACCCTA, AACTACAAATTACCTATAAA, GGGTTGTCACTGCATGTAGG and GTGAGCTGGCCAGTACAGAT, which resulted in a 368 bp deletion beginning at Chromosome 6 positive strand position 129,537,347 bp, GTAATTTGTAGTTGTTTAAA, and ending after GAGCTGGCCAGTACAGATAG at 129,537,714 bp (GRCm38/mm10). This mutation deletes exon 2 and 79 bp of flanking intronic sequence including the splice acceptor and donor. There is a single bp insertion G at the deletion site that will not alter the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 30 and early truncation 6 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Gabarapl1 Mutation:  15 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory