Saraf^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Saraf^em1(IMPC)J
• Name: store-operated calcium entry-associated regulatory factor; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5795835
• Synonyms: Saraf^em1J
• Gene: Saraf Location: Chr8:34621733-34638001 bp, + strand Genetic Position: Chr8, 20.9 cM, cytoband A3
• Alliance: Saraf^em1(IMPC)J page
• IMPC: Saraf gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Saraf-7950J- F6680 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CGTCAGAGACTAGGTCTACT, CTTCTTAGACTGCTGGCGGG, GTTAACCTCCTCTTCAAACC and ACCCATGGACCCGCTGAGCA, which resulted in a 501 bp deletion beginning at Chromosome 8 positive strand position 34,165,102 bp TAGACCTAGTCTCTGACGTT, and ending after GGCCAGTCACGTGCCTGGTT at 34,165,602 bp (GRCm38/mm10). This mutation deletes exon 3 and 101 bp of flanking intronic sequence including the splice acceptor and donor, in addition there is a 4 bp deletion (CCGC) 26 bp before the 501 bp deletion which will not alter the results of the mutation. This exon deletion is predicted to cause a change of amino acid sequence after residue 125 and early truncation 109 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Saraf Mutation: 22 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)