About   Help   FAQ
Slc25a46em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Slc25a46em1(IMPC)J
Name: solute carrier family 25, member 46; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5790100
Synonyms: Slc25a46em1J
Gene: Slc25a46  Location: Chr18:31713217-31743585 bp, - strand  Genetic Position: Chr18, 17.79 cM
Alliance: Slc25a46em1(IMPC)J page
IMPC: Slc25a46 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Slc25a46-7953J-M6621 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AATCTGTTAATAAAACCTAA, TCACTTTGAGGTTTATGCAG, TCAAATTCTGATATGGAACA and GTTTAAATAGTGAATGACTC, which resulted in a 365 bp deletion beginning at Chromosome 18 negative strand position 31,607,404 bp CAGAGTCATTCACTATTTAA, and ending after AGTCATTCCACTGCATAAAC at 31,607,040 bp (GRCm38/mm10). This mutation deletes exon 2 and 322 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 94 and early truncation 70 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Slc25a46 Mutation:  24 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory