Nim1kem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Nim1kem1(IMPC)J |
Name: |
NIM1 serine/threonine protein kinase; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5790097 |
Synonyms: |
Nim1kem1J |
Gene: |
Nim1k Location: Chr13:120171630-120217418 bp, - strand Genetic Position: Chr13, Syntenic
|
Alliance: |
Nim1kem1(IMPC)J page
|
IMPC: |
Nim1k gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Nim1k-7775J-M6390 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGCTTTGGAGGCATGGACCA, GCCATGGGAACCGGGAACGT, TGATGATGATGTGTTATAAT and CTTTATTCTATTAGACATAG, which resulted in a 603 bp deletion beginning at Chromosome 13 negative strand position 119,714,667 bp GTTCTGACCAGGAGTGCTCT, and ending after CCTGCCATGGGAACCGGGAAC at 119,714,065 bp (GRCm38/mm10). This mutation deletes exon 3 and 334 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 97 and early truncation 1 amino acid later. In addition there is a 7 bp deletion (tccatgc) 96 bp after the 603 bp deletion that will not alter the results of the exon deletion.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|