About   Help   FAQ
Nim1kem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Nim1kem1(IMPC)J
Name: NIM1 serine/threonine protein kinase; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5790097
Synonyms: Nim1kem1J
Gene: Nim1k  Location: Chr13:120171630-120217418 bp, - strand  Genetic Position: Chr13, Syntenic
Alliance: Nim1kem1(IMPC)J page
IMPC: Nim1k gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Nim1k-7775J-M6390 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGCTTTGGAGGCATGGACCA, GCCATGGGAACCGGGAACGT, TGATGATGATGTGTTATAAT and CTTTATTCTATTAGACATAG, which resulted in a 603 bp deletion beginning at Chromosome 13 negative strand position 119,714,667 bp GTTCTGACCAGGAGTGCTCT, and ending after CCTGCCATGGGAACCGGGAAC at 119,714,065 bp (GRCm38/mm10). This mutation deletes exon 3 and 334 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 97 and early truncation 1 amino acid later. In addition there is a 7 bp deletion (tccatgc) 96 bp after the 603 bp deletion that will not alter the results of the exon deletion. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Nim1k Mutation:  21 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory